Getting Genotyped with the Illumina ForenSeq Kit and MiSeq FGx

A month ago, our facility had the opportunity to try our hand at the Illumina ForenSeq DNA Signature Prep Kit which came with our MiSeq FGx. The MiSeq FGx is similar to the regular MiSeq except it has a forensic genomics mode. Together with our friends from the UP Natural Sciences Research Institute (NSRI), we performed an in-house bench test of our new toy. The absence of the need to spend additional money and the demand to perform machine validation made up the perfect excuse to get ourselves genotyped. Come to think of it, there is no way I am ending my stint in the Philippine Genome Center (PGC) without having my genomic DNA sequenced one way or another.

What sort of information can we get from the ForenSeq Kit and MiSeq FGx? Autosomal, Y- and X-chromosome short tandem repeats (STR), identity-informative single nucleotide polymorphisms (SNPs), and ancestry-informative and phenotypic-informative SNPs depending on which primer mix was used:

• Primer Mix A - up to 96 samples per run; 58 STRs (27 autosomal STR, 7 X, and 24 Y haplotype markers) and 94 identity-informative SNPs
• Primer Mix B - up to 32 samples per run; markers from Primer Mix A, plus 56 ancestry-informative SNPs and 22 phenotypic-informative SNPs

To summarize that mumbo jumbo, Primer Mix B provides much more exciting information: it can tell your biogeographical ancestry, and the color of your hair and eyes. Unfortunately, we didn’t have the luxury of using Primer Mix B. How fantastic it would be if I could introduce myself this way: “Hi, nice to meet you. I’m Sarah, and I’m in the middle of the East Asian and Ad-mixed Americans reference populations. My hair color is 97% black and 3% brown. My eye color is 97% brown and 3% intermediate.”

[Forensic Loci of the ForenSeq DNA Signature Prep Kit]

The ForenSeq workflow was rather quick and easier to carry out than the usual library preparation kits. An experienced user should be able to process 96 samples in a day. Essentially, the gDNA is amplified and tagged using a preset oligonucleotide primer mix with regions specific to sequences upstream and downstream the short tandem repeats (STRs) and single nucleotide polymorphisms (SNPs). The indexed adapters for multiplexing (enables multiple samples to be pooled and sequenced simultaneously) and cluster amplification (the magic that happens on the flow cell) are added later on. The sequencing is completed in the MiSeq FGx using the MiSeq FGx Reagent Kit (take note, this is different from the MiSeq Reagent Kits). Data analysis happens onboard with the ForenSeq Universal Analysis Software (UAS).

[MiSeq FGx Forensic Genomics System Workflow]

What did I learn about myself then?

• Not that I’ve had any doubts, but I am rather glad to know that I am indeed a biological female. XX, baby!
• Which bases occupy certain loci of my DNA (e.g. C,T genotype for my rs876724 locus)
• Repeat structure of certain STRs of my DNA (e.g. 8,8 genotype and AATGAATGAATGAATGAATGAATGAATGAATG repeat sequence for my TPOX locus)

Should the results of my genotyping be submitted to a genotype database, I can then be identified as a perpetrator if ever I commit a wrongdoing and leave DNA evidence in the crime scene. Had this been a case of targeted sequencing with a cancer or inherited disease panel, I would probably be averse to opening the Pandora’s box of my genetic material.

Overall, this kit is pretty nifty for its purpose. My only gripe is the wasteful use of the depth of coverage with a maximum multiplexing capability of only 96 samples (14M reads and 15 GB output per run vs. 200 loci with an average amplicon length of 250 bp). Until now, the 384-multiplexing feature is said to be under development.

References:

Illumina. 2015. ForenSeq™ DNA Signature Prep [Internet]. Available from: https://support.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/forenseq/forenseq-dna-signature-prep-guide-15049528-01.pdf

Illumina. 2015. Targeted Next-Generation Sequencing for Forensic Genomics [Internet]. Available from: https://www.illumina.com/content/dam/illumina-marketing/documents/products/appspotlights/app_spotlight_forensics.pdf

Illumina. 2016. Data Sheet: Forensic Genomics [Internet]. Available from: https://www.illumina.com/content/dam/illumina-marketing/documents/products/datasheets/forenseq-prep-kit-datasheet-1470-2014-003.pdf